video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Substituting y=-2 in the equation Solve the problem -2x+_____=-12
Why do the people in the Republic by Plato remain in the cave?
Approximately how many atoms of carbon are present in a 120 gram sample of carbon?
Help, please! I have only a few minutes longer- 20 points.
What were American women contributions during WWII?
How do the Dry Pampas and Wet Pampas contribute to the economic health of Argentina.
history of Santa Fe how was it colonize
Genetic inheritance is being studied in a certain species of plant in which orange flower color (O) is dominant to white (o) and round leaf shape (S) is dominan
I need help on this question and every time I get help on this question some people get it wrong. can someone give me the right answer, please?
Who when where and why happen in Santa Fe New mexico