spanglerh10
spanglerh10 spanglerh10
  • 02-12-2021
  • Mathematics
contestada

what is 4 divided by2/5

Respuesta :

095806
095806 095806
  • 02-12-2021

Answer:

10

Step-by-step explanation:

Answer Link

Otras preguntas

A rumor starts that says a bank has suffered significant losses and may not be able to honor its promises to depositors. This causes most of the depositors to l
Write 3 antonyms for the word halt and use it in a sentence.
How many cups do they use with 20 tablespoons of honey
Erin has been living with her boyfriend for a year. During that time, Erin has heard her boyfriend and his family make many negative comments about Asians. When
Do you think that this book or movie's vision of the future is accurate? Rate your answer on a scale of 1 to 5, with 1 being least accurate and 5 being most ac
f(x) = x2. What is g(x)?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
who was the first president of the united states ​
match the correct y=mx+b equation to the graph: pls show work/explanation!
ordan Electronics currently produces the shipping containers it uses to deliver the electronics products it sells. The monthly cost of producing 9,200 container