KhloiV83116 KhloiV83116
  • 03-11-2022
  • Mathematics
contestada

solve equation 10 - 25x = 5 what is the value of x

Respuesta :

DevonneX289633 DevonneX289633
  • 03-11-2022

ANSWER

x = 1/5

EXPLANATION

We are given the equation:

10 - 25x = 5

To find the value of x, first we subtract 10 from both sides of the equation:

10 - 25x - 10 = 5 - 10

10 - 10 - 25x = 5 - 10

-25x = -5

Now, divide both sides by 5:

=> x = -5 / -25

x = 1/5

That is the value of x.

Answer Link

Otras preguntas

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
I want to work with LDAP. what is LDAP?
how would u form a superlative for the adverb widely
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system